EST 1737135 is a singleton


Sequence

>1737135 (1 EST) Length=241 CAGCAAGGCGAAGTTATATTTTATTCAGTCCAACATACTGTTTCACTAAAGAATATGAAGTTTTACAACAGAAAGTAGCT AACTGTACAATACAAGTAAATTGGAAACAAAAAAAAAGTAAAAAACCTGAAACTCAGTCATTAATGTAAACAATCAAATT TCGAAAACAAATAAGAAGATAGCATACACACATTTATCAAATACTTGAACTAAGTATTTTGACATCCGTATCAATAGGGA A


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1737135: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17371353190055AA999500MCCE3403.M1FSchistosoma mansoni, cercariae


Date: 19:24:33 on Fri 24 Nov 117.