EST 1737143 is a singleton


Sequence

>1737143 (1 EST) Length=310 ACGTGACAACCCAAGACTTTTATATTTATTCAACAAAACGACTCTGAGTTTGTAATATGTTGTCTTTTAAATCGGAAACA TTTGGAGTTAATTCGTAATTAGTAATAACGGCTTCTCGTCTCGGTGCTGGAGTATAATCTCCCCGCAAGCCAATGTAGTG AATTCGTGTTGTATCACCACCGTAATTAGCACTGAAATGTTTTCTCAGTGTTTGCACATTAGAAAAGCGTGAAATTTTCA ATGGGTATATCACTTCACCATTTGGGTCAATAAGTTAGTTCGAGTGATTGGTTCACATTCAGCCTATTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1737143: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17371433190063AA999508MCCE3414.M1FSchistosoma mansoni, cercariae


Date: 16:23:10 on Fri 17 Nov 117.