EST 1737145 is a singleton


Sequence

>1737145 (1 EST) Length=215 ATTACTAAAACGTGTAATTGACAGCAAACATTTGTATAATGTTAACATATTTATGTAAAATAATACATTTAAACACAGCA ACAAATAGGAAAAAGTGTAGACACAAATTACCAGTTACATGAAAAATAAAAGTATTGAAACTGTACAATTATTCACAGCC TTGGTGTACTTGGGACCATATTTGTATGATGTATACATACATAATNTTTTGTAGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1737145: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17371453190065AA999510MCCE3416.M1FSchistosoma mansoni, cercariae


Date: 14:9:57 on Fri 17 Nov 117.