EST 1737146 is a singleton


Sequence

>1737146 (1 EST) Length=300 AACGATAATTTTTTTTACTAAATTATATCACTTCATAAACTGAAGAGTAGTTATCAATTGAATGCTTTATTTTGATTTTA CGGAAAGTTATGTGATTATCACCATAATTTTCATCATAGGTTCACACAGATATCCCGTAATATAATAGGAGTGAAATAGA ACACATACGCACTGGAAAATAACATCAAAAGTTACAGGCAGATTTTATCAGAAAAAAAGAATGAAATCGAACAATTTTTA GTAATTCATAAAAAGGGAAACATTGAAAAATGTTGAATGAAATCATTGGGCTTTATCTTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1737146: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17371463190066AA999511MCCE3418.M1FSchistosoma mansoni, cercariae


Date: 13:19:57 on Wed 22 Nov 117.