EST 1737201 is a singleton


Sequence

>1737201 (1 EST) Length=404 AAAACAATTCCAAGGACTTTATAGTAATTGGCTTAGTAATTAGAATGAAATGTCGTCATCGAGTAAGACCAGAAAGTAAA TAGATAATTTTAAAAGCAATAAGTAGCATAAAGATCCGTAAAAAAAACTGTAAACACAATATATACGAAGTACATAAATA AATATAAACAAAAAGCATAATTATAGAAAGCGTATGTATAAAAGAACTGGAATAAAACGAAATTAGTTCCAATACCTAAT CAAGGAAAGTTATTCGAACAATCACTGACGTGACGTAAACGCCAGTGTGCTGAATAGTTGCTGACAAAAAAGAAAAGCAG TTCCAAAGTTAGTGTGGAATGAACGAANCATAAGTTGGGTACGAATGATAAAAATCCTACAATTTAGGGGTTTTTAAATA CATA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1737201: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17372013190121AA999566MCCE3493.M1FSchistosoma mansoni, cercariae


Date: 11:9:13 on Sun 19 Nov 117.