EST 1737209 is a singleton


Sequence

>1737209 (1 EST) Length=259 AATTGCTAAGCACAAATCTTTGACAGTTTTATTTTCTAATCAAACTAACAAATTNAAGTNTAAGTCGTTACGTAAAGAAC CTCCCAAATAAGTTTTTGGGGTTAATCCAATACTGACGTCGCAAGAAATAAATGAAATGCACTAAAACAAGTGGGAATTT GTTTTGAAATCCCGCTTTTTGAATTTGGGTAATTAAACTCCTAAATAAAACCCATAATAACCAAATCCACTTTGAAAAAT AAATATTAAGCCTTTTGAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1737209: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17372093190129AA999574MCCE3519.M1FSchistosoma mansoni, cercariae


Date: 23:26:10 on Sun 19 Nov 117.