EST 1737214 is a singleton


Sequence

>1737214 (1 EST) Length=539 CTGAAATAGATAACTTCTCTTAAACTATACAAATAATACTGCACATTAGGTTATTGACAGATGATTCAAAATCACTGATC AAAGTATTTAACTAAAGAGTTGCATCTAAAGAATCCAGTAGATGGATTTACATAATGTGAAAAAAGTATACAAACCAGTA TAACAGATGAATAACAAATATATCAACAAAATGCACTTCCAAAAATAACCGGAAGAACAGTAAATCAAGTGAAAATGAAA AGTACACAAATAACATCTACATGCAATACTGTTGAATATACAACGCATTATGATTATTACAGTAAAAAACGAACTTTCCT TGCATGTTTTGAAAATAACCACACCGAATTCAGAAATTGCACTAATTTTAAGATGTGGGAGGAGTTTTCGTTTAAGCAAG GAGTAAAAGTTAGGAGAAGCCTCCAAACACATTGTTAATACTGCACAGAAGTTTGGTTCATGTAAATTGAAAAACTTAGA TAAAATACAAATGCGGGTGCTACAATTTACTTTGCATGATAAACAAGTATAAGTTGGAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1737214: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17372143190134AA999579MCCE3527.M1FSchistosoma mansoni, cercariae


Date: 6:11:27 on Thu 23 Nov 117.