EST 1737215 is a singleton


Sequence

>1737215 (1 EST) Length=388 GAATATGATACAGCNCAATTTATTTATATGATAAGNATCACCGAATAAGAAGAGTACACCAAANATGCATTGATTTTCCT CTTCACATGAATATCTCAAACGTAAAGTCAAACTAAAGAATAATAATCTGAAGTTCCAGTTTACCATAGTAGTAGTAGTG GTAGTAGTGATCATTATAATAATGACAAATATCATGGAATATTGANGTAAACTATTGTGGTTTTTTTTGAGTTTGAGTAT ACATGTATATATAAACATAGAGGGAAAGATTGATCCAAAGCTCTTTATCACTGAAACTTTTTAAAGAACTTTAGTTTACA ACACAACACAAAAAAAGACATACGTACCATGTACCCATACATAAAGAAATAATTATGAGATCATTTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1737215: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17372153190135AA999580MCCE3535.M1FSchistosoma mansoni, cercariae


Date: 7:22:58 on Mon 20 Nov 117.