EST 1737222 is a singleton


Sequence

>1737222 (1 EST) Length=297 AGATATCAGAAGTGTATATTTGAAACTTGAATAATAAACTTAATATTGGGCAACAAATAAAATGGTAAAACAATTTCTGA TGGTATCATTCAAAACTGGAAGGAAATATAAGAATGTATCATTTTAAACATACATGATATAATAATGACAAAAACAATTA AAAATTCGCTCCTTTAAAATTCCAGTTCAAATTCTTCATNCACGTGTAATTTCAAGAAATTTCCCATTTCAAAATGAGGA TTCCAATTCCTTGAACAAAAACAAGTGCAACAATTAGAAAAAAATTAACTGGCTACA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1737222: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17372223190142AA999587MCCE3547.M1FSchistosoma mansoni, cercariae


Date: 20:36:1 on Thu 23 Nov 117.