EST 1737224 is a singleton


Sequence

>1737224 (1 EST) Length=334 AGTAAAGAACAAAAATTTATTTATTTATTTTTTTCAATTTTCTATGCAACATTATTCTAATGATGATGTTGAAACAATGA AGATAAGAGCATATATATATAGGATAGAAGAAACACTTACATGTGCATGTAATGTAAATAGATCATTTTCACATATATTT TAGTTGTGACATAAAAGTGACAATGATGTTTGACAGCATTGAAAATTGTAGTAATAATAATAATAATAATAATAGATAGT ATGATAATAAATATAATGTAAGACAAACAAATGACCCTAAATGTCCTAATACAATGTGCAAGAGCCCATTAGACCGGTAA GCCATCCGAACTAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1737224: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17372243190144AA999589MCCE3549.M1FSchistosoma mansoni, cercariae


Date: 19:37:35 on Mon 20 Nov 117.