EST 1737225 is a singleton


Sequence

>1737225 (1 EST) Length=349 AACCTATTTATATTATTATTATATATATTTTTTCAACAATGATAATAATTAAACAATGAGAATTACATGTATATACGTTA TGTAAGTGTATGCGTACACACACACACACACATGTGCATATTCCCTTTTGCTTCATTCATATGAAAACATACACAAATTA AAAAACAAACAAACAAACAATTAAGTAGTAATTAGTAGTATCAATAGGTGAATTGGAAAAAAAAACTATGATTAACCAGG GATGTGAATAACAATAGAAATATATGTTCCCGACTGAACATAGAGCATCATTATTATTATGATTATCTCTATAAGGATTT ATTTACCAATTATTATTAGACAAACAAGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1737225: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17372253190145AA999590MCCE3550.M1FSchistosoma mansoni, cercariae


Date: 21:8:12 on Fri 24 Nov 117.