EST 1737226 is a singleton


Sequence

>1737226 (1 EST) Length=327 GGTTCAGCGTGGTATATGTTTAAGAGAATTTTCAAGTACATTGCTCAGTAATTTCTGTTTCTATGGATTTTTCCAAAGAG CACGTATCTATTTTCCTCTTTTTACGTAACTTTTCCATTTTCTCATCCACAGTAAGTTCCACATGTCTTCTAGATAGCTT CTTAATTACAGTTTTCTTATTAGACGGTTCTAAAGGGTTAATAAATTTAGCCTCTGGAGATATTTCGTCCAAATGATGAT TGATTAGTGAGCTATTTGGGATGGTACCTGTAACAAGAAACATATTAGATATGGATGTATGTCGACAAAATTATTTTAAT GAAAATC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1737226: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17372263190146AA999591MCCE3551.M1FSchistosoma mansoni, cercariae


Date: 21:19:19 on Sun 19 Nov 117.