EST 1737230 is a singleton


Sequence

>1737230 (1 EST) Length=332 AAAGGTCTACACACTCCGGTTTGAGCCAGGGGTACTACCAAAAATGCCTAAACTGAATTCAGTTTCAAATCTACAACCTA ATGGTTGACACCCGGGGGTACTTTGATCATAATTCAATTAATAATGGTAATGATAATAAATAATAAGGGAATATTACTGG GCACTTACATTCCCGATCCGCCATTGTTATCTGAAAAATTGTCATTGCTAGAGTTAAAGGGATCCGAAAAGACAGGTTTA ATTTGTATGCCTAAATTTTCACCACGTTTAGTATTTATCAGACGAATTGTCACTATTGAGTCTTTACTATTTATTGATTC CTGAGATTTATT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1737230: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17372303190150AA999595MCCE3557.M1FSchistosoma mansoni, cercariae


Date: 0:55:28 on Fri 24 Nov 117.