EST 1737231 is a singleton


Sequence

>1737231 (1 EST) Length=330 GCAAGAGAATCCTTTCCGTTGAATTTAATGATGAGAACAATCAATAAGAAGGGTACAAAGTAAACAGTTCAAATTTGGAT GCTTGTAAAAATATTAATGATCAGTTACAAATTTATATTCATATTATTGTCTTACATCAATTCAACGGAAATTGTAAAAA TGCTAAATTGTCATATAGATAAAGTGTCAAATCAAATTGAGAGTAATGAAGATACGAACGTAACTATAGCCACATACAAA TCTATGGCAACGATGAATCCATACTTTAACAATTTATATTTATGAAACTTAATAAGAGAGGGTTGAGAAATAAACTGAAT AAATATGGGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1737231: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17372313190151AA999596MCCE3558.M1FSchistosoma mansoni, cercariae


Date: 7:31:38 on Sat 18 Nov 117.