EST 1737235 is a singleton


Sequence

>1737235 (1 EST) Length=350 AATATATAACTTTCTCTATTATTTAGATTACTTTTGAACAACGTATATATTTATGTCTAGAAAAAAATGATACATCAGTT GAATATACCAACTTTCAAACATAAATAATTGGAACCTTGAAATTAATAGTACACTAAAAAAAGGAAAAAAAATTCACCAA TTCAAATGATTAGAACAATAATGCAAATAAAACAAACCAAAGAAAATCAATCACAGGCAAAGCAAATATGACTAAAAGAA GGGGGGAAAGCAATAAAAAACAAAATATTTTTCAAGAAAAAATATTCCCAATATTACACAAAAACAAACTTAGCCCTCCA CAAGAAGCCCCCATCAAAAAGGAAAACCAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1737235: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17372353190155AA999600MCCE3564.M1FSchistosoma mansoni, cercariae


Date: 5:54:35 on Sun 19 Nov 117.