EST 1737237 is a singleton


Sequence

>1737237 (1 EST) Length=398 CGAAAAGGTTAAATTATGCATGAGGTTAAAAGATTAGTTCTTATCAAACAATCCAGTCAGTCATATTGAAAAAATGTTTT CCAAACTGTTGACATGCAGAAAGCATGATAAACGGAAAAGTAAAACGAACTCAACTATGTCGCGTGACAAAAACATGAAA AGAAAAATCGTTTGCAATCATATTGAAAACGTTAACTTCACGACATATGGCTAAGCCTTTATTTTGGAGATAAGATTCAT AGTGAAAAAAGTAAAAGCGTTGGAAGATGGTATATCAATTTGAAACTTTTGGTTGTCTATGCAAATACATTGGATTGATT TCCTTCCTAAAGTAACAAGTAATGTTAGAATGAAAAGCACTCAACGACGTCGCCAANTTGGTACAACTTTGAATGGAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1737237: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17372373190157AA999602MCCE3566.M1FSchistosoma mansoni, cercariae


Date: 11:30:30 on Fri 24 Nov 117.