EST 1737245 is a singleton


Sequence

>1737245 (1 EST) Length=254 AAGCATCAATATCAGCTCGTCTAGATGCTCTTGGTGAAGAGGGTGCTGACACAGAAATGGGCATACGAGCAAGGGCATAT TTAGAAAAAAGACTTCGACAGTTAGAAGCTGGAACTTTTAATCCAAAATTATCGGCGGTTAAGCGGGGACTAAAGTCAGA GGATGGTCAACCGAAATCAAAGAAGATGAAGGTGGACGAGTGAATAATAATCATTTCAATGTACATATGTTGCAAAAATA TACATTATCACCTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1737245: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17372453190165AA999610MCCE3581.M1FSchistosoma mansoni, cercariae


Date: 7:30:18 on Sun 19 Nov 117.