EST 1737246 is a singleton


Sequence

>1737246 (1 EST) Length=278 ACCCATTGTATTGCGCATTTCTATTTTCCATCATAAAGATCAATACAGAGAAAGTTAACGGGTGTTTGGTCCTTGGGTAG TGTGTTCAGAGCTTCTGTACGTGAATGGCTGTGACGCCTTTCTTCAGTTTGCGCAACTTAGTCCTGAACAAGTGCAATAA TTTTTTACTTCCTGGATCATCCCGAGATAAATGCTACAAGTTTCTGCTCGATGGCTACTTTGTCGGGTTCATTCACCCAA TGTTTTTGGATTGGCTATTGAAATATGCGAATGTTTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1737246: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17372463190166AA999611MCCE3582.M1FSchistosoma mansoni, cercariae


Date: 12:1:37 on Thu 23 Nov 117.