EST 1737253 is a singleton


Sequence

>1737253 (1 EST) Length=188 GCAAATTGATTTATTGTACTATTACATATTTATTCACTGTAAGATATCAAACTGTCATTTGTTACATTTTAAAAGATACA ATCCTGAATGGTTGGTAAGCAAACTTGCCAAATATAAAAACCTATCTTATTCGTTATAATGTCCTCTTCTATAGAATTGN GGATNATTTAATACCCCCTTCATTTTCA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1737253: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17372533190173AA999618MCCE3594.M1FSchistosoma mansoni, cercariae


Date: 13:52:26 on Thu 23 Nov 117.