EST 1737255 is a singleton


Sequence

>1737255 (1 EST) Length=292 AATAAAGATAACTATATTGTAAGTGAGTGACATATGTACATTCCGGGAAATAAAATAATGTACGAAAGAAACAAATTAAT TTACTTGAAAGAGGAAATGAAATAATATATATAATATATTGGCACGAATCGCGCTGAGTTTTCTAACCTACATATGTAAA TGAAACAAACTTTTTAAAAGATGAAATAAGAAGCTATTTCCATACAAAAAATAATCAATTTTCTGTAAAAAAAAAAGTAC TTTCGAATGGCACCAAAACAATGTAATTGCATTATCACAAATATTAAACATC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1737255: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17372553190175AA999620MCCE3598.M1FSchistosoma mansoni, cercariae


Date: 6:6:1 on Thu 23 Nov 117.