EST 1737257 is a singleton


Sequence

>1737257 (1 EST) Length=286 CTAACAAATATATGAATGTATTTAATTACAAATTAAACGGATAATAAATAATAAAATTTCGACTTAATAAATGAATAAAA GAAAAAAACTGAACAAGGAAAGATTTCAACAGGTTAATATTTTTTTCTCACTTTCTATCACAGGTTCGATCTCCATGTAT AAGTCCATGTCTATCTCCATCTATGTGTGTAGATATGTGTGTAGTGTATATCATTAAAAAAGGTATAAAAACACAAATAC AAAACAAGTATAGTGAAATACCTACCCCATTGAAGGCCATTCATTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1737257: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17372573190177AA999622MCCE3604.M1FSchistosoma mansoni, cercariae


Date: 22:12:16 on Fri 17 Nov 117.