EST 1737263 is a singleton


Sequence

>1737263 (1 EST) Length=330 GGTGGTAAAATGGCGTTATTATTAATTAATCAATCTTCAGCTCAAACAACAATGTAAAACTTAAGAGATGGTACAGGTAG AATCAGTTATTGAATGACCAACCATAATAGCTCGTAATGATGATAACTATATGTATGTCTTTGCACAAAAACAAAAAAAA CATATTTGGCAGTCACATTATTACTACAGAAAATCTAACGATTGTTTTGCTCAATCAAACATATAAAACAATGGTCGGTA GTTGTATAACAATAAAGAACTGAAACTGTTCAGATAAAATCCTGAAAACAAGAGCATATATATATATATATCATATCTAT ATATATTTNA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1737263: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17372633190183AA999628MCCE3623.M1FSchistosoma mansoni, cercariae


Date: 17:55:50 on Tue 21 Nov 117.