EST 1737264 is a singleton


Sequence

>1737264 (1 EST) Length=202 AGGCAGTGATGAATTTACTACAAAACTATTTTATGGCTATGAGAAAGATTACGAAAGAAACTTATACACTATGAAAATTG AAAAACTAATAAGAAGTTTTGAAAGACTCTAATCAACACCTTGTTGACACTTCGTCAGTTCTGTCTTCAATGATCATCTG GTCAATTTAGGAATTATTCAAATTCAGACCGATCTGATTTCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1737264: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17372643190184AA999629MCCE3626.M1FSchistosoma mansoni, cercariae


Date: 2:13:47 on Wed 22 Nov 117.