EST 1737269 is a singleton


Sequence

>1737269 (1 EST) Length=243 ACTAAAAATAAANCAGTTTATGGGAGCCATCTAAATAACTGGAAAAAATGTGTTCACTTAGCTGTGAACAGGTAANTAAA GAATGAAAACAGAATATACCCGTAACGTTTTTACAAAAGAAAATGGTACTGTTTAGTTATATAAAACAAGTAAATTTAAA GCCTTATTTCCACAGTTTTTTGATGGATACATTTTCCTCAGAAAATTTTTGCATCACCTTAGCAACTGCTAATCTCAAAA TCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1737269: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17372693190189AA999634MCCE3647.M1FSchistosoma mansoni, cercariae


Date: 6:8:9 on Sun 19 Nov 117.