EST 1737276 is a singleton


Sequence

>1737276 (1 EST) Length=150 GATAACTTATCACATTTNATTCCCTAATTAACTGCTAGCAGTAACAATAAGCGGTATTATTATGATTATTATNACTTTGT GAACCATTATTCTTCTATTTCATGTGAAAAGAAGGGGAAAATAACAACTGGGCAGAAATAGAACAACAGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1737276: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17372763190196AA999641MCCE3662.M1FSchistosoma mansoni, cercariae


Date: 6:17:55 on Fri 24 Nov 117.