EST 1737279 is a singleton


Sequence

>1737279 (1 EST) Length=420 GGCATTCCAATGTACATATATTTCAAGGAGGGGGGAGAGAAAGGGGAGAACTCTACAATATATAGGTATATGTGTGCATA CAACACAACTCCACCTGTAGCCACATGGAATCCTGAAGACCAAAGAAGAAGAGGAAGACCAAAAAACACATGATGCCGAG AAACAGAGACAGAAATGAGAAGAATGAACAAAAAAATGGATAGAACTAGAAAAGAAGGCCCAAGACAGAGTGGGTTGGAG AATGCTGGTTGGTGGTCTATGTTCCATTACGAGTAACAGGCGTACGTAAGTNAGTTGCATACAACACAATATGAACAATT AAACTGAAATGATTAAAGAGACAATTTCAACTTTAAATTACATTACTGGTACAAATACATTTACTTTTTAAAGCAAAATA TAAGGGTAAGAGCAATAGGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST, Processing,


Cluster Information for 1737279: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17372793190199AA999644MCCE3667.M1FSchistosoma mansoni, cercariae


Date: 2:48:19 on Mon 20 Nov 117.