EST 1737282 is a singleton


Sequence

>1737282 (1 EST) Length=402 CCAATTTATAGAGATGTATATTTATATGACCTGCCTTGTTAAACGAAAAAATAAATAAGTATTTATGTATATGTTTAAGG AAATAATAAATGGGACTAAAAACAAGCCCTCTGTTTTTCTTTACTTCCTGATATGATAAANACAAAACAAAAAAATAAAT CTTGCGACAACATAAACAGAAGAAAAATAAATTAGATAAATAAACAAACAAATAAATCAATAAGTAAATAGAGACAAACT TCAGTAGTCAACTGGCGCAAAAAAAAGTTTTTTTTACAATATATTTCCCCCTTTTTTTGGCCGATCACAGTTTGATGTAA ATATATAAGANCTATATATATGTATTGACATGCTCATGCTCACATGAAGATATATATTTTATTGAAAGGGGGGGCCCTTT TT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1737282: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17372823190202AA999647MCCE3699.M1FSchistosoma mansoni, cercariae


Date: 1:6:7 on Tue 21 Nov 117.