EST 1737284 is a singleton


Sequence

>1737284 (1 EST) Length=409 GCACGAGATTGGGTGTTACGAAACCCAAAGGCGAAGTGAAGGTAAAGGTTCGGCTTGTCCGGACTAAGGTGAGATCCTGT TGTCTTGCTCATACTTTCCAAGTTGCGAGCAGCGGGCGCATCACCGGCCCGTCCCATGACGTAGACATGTGACCTCGTGT TGTGTGCACCGTCGGGGCGGAGCAAGAGCGTACACGTTGAGACCCGAAAGATGGTGAACTATGCTTGTGAAGGTTGAAGC CAGAGGAAACTCTGGTGGAGGACCGTAGCGATTCTGACGTGCAAATCGATCGTATAACGTGAGTATAGGGGCGAAAGACT AATCGAACTATCTAGTAGCTGGTTCCCTCCGAAGTTTCCCTCAGGATAGCTGGCATTCTGAGAAAAAAACAGTTTTATCC GGGAAAGCG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST, Processing,


Cluster Information for 1737284: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17372843190204AA999649MCCE0218.M1RSchistosoma mansoni, cercariae


Date: 16:31:35 on Fri 17 Nov 117.