EST 1737290 is a singleton


Sequence

>1737290 (1 EST) Length=337 GTAATAATAAATGCTTTATTCATTCGGATCCCAATAAATAAATAAAATNANAGATTTGGTTTTCACAGTTGTGCTAATCA ATGTGACTGNNAGGGAAAGATTTTTAAGACAAATTATTATTAAGTTTAGAAATCAATAAATAAATAAGGAAATAAATATG CATATTTTTGTGTGCAACATGTAAATCAAATAATGCACATATATTTACTGATAAATAAAAGTGTTACAAAGATGAAAAGA AAAAACAAAATCTATAATAACAGATCAATAGGGGAGGGTAAACATGTCTTTAAGTTCTTCTTTTAAGATTAGTAGTCTTA TGGATAACAATAGTTAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1737290: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17372903190210AA999655MCCE0120.M1FSchistosoma mansoni, cercariae


Date: 6:21:44 on Fri 24 Nov 117.