EST 1744249 is a singleton


Sequence

>1744249 (1 EST) Length=324 CAACAACACACACAAAGGAGAGAGAACAAAAATAAATCAAAAAAATTCTATGGAAATTGTGTGGTTCACGTCACATTCCA AAACAAAACGCCTAGAGTAAACGAAGCAAACACGCACAAAAAAAAAAAGACCCTTTGTAACGCAGCAAATCCCTCTTTTC TTTACATCTATGTAAAATAACGAAGAAAGGAGGTAATTTGAAAGCGGACAATCAACGCACAATGGAGGATTTCTCCCAAA AATAAATAAATAATAAAAAGTAAAAATAAAACACAGGGCAAATAAAAATCTTGGGTGGGAAAGAAGTTCGCCTCTTTCGT GCTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1744249: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17442493215190AI005680TENU0312T.cruzi epimastigote normalized cDNA Library


Date: 0:52:55 on Fri 24 Nov 117.