EST 1744253 is a singleton


Sequence

>1744253 (1 EST) Length=258 AGAATGTCACCATCAAGAGGTAGAAAAATTGAAGCCATTTCACTTACTACCAACGCCAAAACTAGTTTACCGTGTATCCC AGTATATGTGCATGCCATATTCCCTCTATCTGTTTGTCTGTTTGGTTGTCCCTAACACACGCACAATCTTACAACCGTAT TTTTTAAATATGTTTCATGGCATATCGGGATCCATTTCTTCTTCTTTTATTATTATTATTATTATTATTATTATTGTTGT CCCCCCATCTTGCTGGTA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1744253: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17442533215194AI005684TENU0316T.cruzi epimastigote normalized cDNA Library


Date: 21:20:12 on Sun 19 Nov 117.