EST 1744261 is a singleton


Sequence

>1744261 (1 EST) Length=310 CTTTTTTTTTTTTAGTTTTTGTTTGTTTGTTTTCATGAATGCATGCGTACACGCGTACGGATGTGTAGGGGAAGTCTTTA AGGAAAGGGGAAAGAGGAGTTGTAATGTGCATAAATAACTTTCTCTTCGTCACTGTTCCTCAAAAAATTCCTTCCTCCTT CCTTGCAGTGTTTAGGCATCGGCCGCTGTGACAATTTTCCCGGCGGGCAGCAAACGTAACTGCTCCTCTACCATCGATCG CAACTTCTTCACACGTTCCAGCAGTTGTGTGTAAACAGCGCCCGTCGCCTGGGCATCTAAATAATCGGAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1744261: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17442613215202AI005692TENU0324T.cruzi epimastigote normalized cDNA Library


Date: 0:31:15 on Fri 24 Nov 117.