EST 1744263 is a singleton


Sequence

>1744263 (1 EST) Length=275 AAGATCTAAACAAAACGCTATAGTAATTCCCCCATTGCGTACCCATCACAGCTTTCCAATGAGAACAAAAAAAACAATAT ATAAATGTATTAATACATGTGTATGTAACCCATCTCCTCATCCTCTTTTTATTCTCCTTTGGGTTTATGTGACGGAGTGC GGTTGCAAGTTTGACCTCGATTGTGGTTGCTAACTGTCCAATGCCTTGACTCTCTTGTAGGCCCAGCTGCGGTACAGTAT GTACCCGTTTACGGAAGCCAGACACATGTTAACGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1744263: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17442633215204AI005694TENU0326T.cruzi epimastigote normalized cDNA Library


Date: 0:25:8 on Sat 25 Nov 117.