EST 1744265 is a singleton


Sequence

>1744265 (1 EST) Length=232 AAAATGCCCCAGGGCGTAAATATTCACCGCTCCACTAAAAAACCTCCAAAAAAAAAAAAAAAGAATTGTGCTAACAAAAA CAAAACAAAACAAAAGAAGACCAAACCAAAAATTCCCCTCCCCCCTGCCGTCCTCACACGTGACGCGCAGTTCCGTCACA GCCACACGAACGCATGCCACCAAAACTTTGGCCCAGACAGGGAGTCTCACACACAAACCAAAAAAAAAAAAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1744265: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17442653215206AI005696TENU0328T.cruzi epimastigote normalized cDNA Library


Date: 23:29:17 on Fri 17 Nov 117.