EST 1744271 is a singleton


Sequence

>1744271 (1 EST) Length=314 CCGGCTCCACAGTCTTCTCCTGAAGGGGTAAAGAAAATTATTTATGACGACCGGCGGTACAGAAGAGGCGGCAAGGCCCA ATCCCCACAATCAGCACAACAAAATTTTAAGCTCGCGGATGTGCACCGTCTTCCCTCCACCCAAAAAATCAGAAACACGT GTGAGTGAACATTAACATTAATCCTTTTTTCCATGTTCCACCTTTATTTTCCTCAAATAAAAACAACAATTCCCCTCTCC TTACTTTCGTTTCTGCCCCGACGCCTCCTTCAATCCCTCGTTTTCCTTCGATGATGAGAAATCTCTTCACGCAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1744271: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17442713215212AI005702TENU0334T.cruzi epimastigote normalized cDNA Library


Date: 17:6:7 on Wed 22 Nov 117.