EST 1744278 is a singleton


Sequence

>1744278 (1 EST) Length=277 GGCGAATCGGGCGCACCACCGGCGGCACCCGCATGGTGTATCTCGTGCACGCCCCGCGCACGCACGGCGAAGGGCGCAAC ACCAGAAGGGCCAGCACGGAGAGAACCACTGAAAGGCACAGACCCGCCGCCGCGACGTAAGCCCCAATCAAACCAGTGCA CCTCCACCTGCACCGCTGGGACGCAGCGGGACGCGTCGCCAGAAGGTGCGGGGTACGAGCACGCGTGCCCGTTCGGGGTG TCCTTGAGAAGCGTGGAGTAGCACATGTCGTCGAAGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1744278: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17442783215219AI005709TENU0341T.cruzi epimastigote normalized cDNA Library


Date: 7:38:46 on Sat 18 Nov 117.