EST 1744280 is a singleton


Sequence

>1744280 (1 EST) Length=257 GTGTGTGTGTTTATTTGAACTGACAAAACCAAACAACAACAATAATAATAATAATAATAATACGAAAAGAGAGTGTTTGC GGTGGCATAAAAACAACAACAACAACAACAATAATTAAAAATAATAATAATAACAAAAAAGCCAAATGAATCGAAGGCGT TTGCGTTTCGTTGGCGACTAAGCGATAAGGCCAATGTCGTCAGCAGCGTTGTTTGTCGTATTGACAGCCTCGTGATTCGG TACGACGTACACCTCGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1744280: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17442803215221AI005711TENU0343T.cruzi epimastigote normalized cDNA Library


Date: 11:50:6 on Wed 22 Nov 117.