EST 1744282 is a singleton


Sequence

>1744282 (1 EST) Length=284 ATTTTTAAAAGTAATTGTATTGCAAATATATACATACATGTATAATATGTACGTGTATGTTTCATTTCGCTTATTTTTAA TCTGCAAGCTGATAATAATAATAATAATAATAATAATACATGGTGGAAGGAATAATGAAAAATCTACTGTGGATAAAGAC CAATAGAGCGGCACCAGAAAGAAATGCCGGCTTTCTTTAGTCAGCTCGTCAAACTAGTAGAAAACAACAAAAACCACGCA GATAAATGGTGCTACTCCCCATTTTCAATGGCTCTATCGGCAGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1744282: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17442823215223AI005713TENU0345T.cruzi epimastigote normalized cDNA Library


Date: 19:17:35 on Wed 22 Nov 117.