EST 1744284 is a singleton


Sequence

>1744284 (1 EST) Length=248 CAGCAGCAGTGGTATAAATTGACAAATGGTAGGCCCAAGAAAACACTTTGGCCGAATGAAACAAAACACCGTCTATGCAT ACCGATGAACACGCAACATACTTCTTTCATCACACAATCTAATCTCTACTCATTGAAATCTCTTTAAGTTTCCATTTTCT CTCTTCTCTCATTATTCGCCGTGGTCGTATTCCCTTGCAGTCTACGCGGAGAGGCTGTGATACTGTGAGTAGTACACTCG CTTCTCCA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1744284: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17442843215225AI005715TENU0347T.cruzi epimastigote normalized cDNA Library


Date: 17:8:1 on Wed 22 Nov 117.