EST 1745911 is a singleton


Sequence

>1745911 (1 EST) Length=274 GCAGAAATCGTTACTTGTTTACTGCAATGGAAGGATATTTATGTATATTTCCTTAAGCGGGTTTAGTGTGTAATTGAGAG TGGATCCTGCGCAGAATGCCCCGGCGTTACCGATTATTATCTGTGACAAATTCCCCCCACCACAATTCAGGATGCCCACC TCTCGTCCTTGTTTTGTTTTTGTTTTTCTCTCAATTGTACGTTCCGTCGTAACTTTCGCCTGGCATCCACGCACACGCAC ACGCACACACACACAATAAAAATAATAAAAAACG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1745911: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17459113216852AI007342TENU0362T.cruzi epimastigote normalized cDNA Library


Date: 12:18:19 on Fri 17 Nov 117.