EST 1745912 is a singleton


Sequence

>1745912 (1 EST) Length=399 AATTCCCCTCTCCCACTAAATTGAGGGTATTTCATGAAGATTAAAAACGGTTTCTTTTTTTCTTTTTTCTTTATGGCTGT TTTTTTTCACATCCAAAAACACGAAAAAATTGGGGTAGTGGCTGGAGGGATGCATGAGTCATAGGAGGGTGCGGTAGTGA TAAGAACGCATCACCCCTCTTTTCTTTGCCGCTGGTTTTAGTCCTTCTTTGCTTCTTTTGCTTTTCTTTTCCCTTCGTTC ACATCCGTGTGTTCAATGCGACGTCGCGTTCCCGCCACCCTCACGCCTCTTCATTCTTTGATTCCGCCCAATAAATTTGT CTCCATCTTGTCCTCTTGTCAACCTCCACATTCCAACACCACGCTGCCCTCTGGGTACACGTGCAGGGCATAGCACCCA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1745912: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17459123216853AI007343TENU0363T.cruzi epimastigote normalized cDNA Library


Date: 18:57:44 on Sun 19 Nov 117.