EST 1745918 is a singleton


Sequence

>1745918 (1 EST) Length=199 CCAAAAGGAATTTTCAGTGCTTGTAGCAAACATCGTGGCGGGACTCTCTTGCAGGGGAAGAAGGTAGGAAGCAGGGTGTG TCAAAGCAACTCCACCTCTGCACCGTGTGCCTCAAACAATGCCTTAAGCTTCTCCGCATCGGCTCGTGACATTGCCTTCA CAAGGACGCCTGGACACTTTTCAACGGCTGTCTTCGCCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1745918: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17459183216859AI007349TENU0369T.cruzi epimastigote normalized cDNA Library


Date: 0:50:53 on Wed 22 Nov 117.