EST 1745919 is a singleton


Sequence

>1745919 (1 EST) Length=290 CCTATAAACAAAACAAAAAAGGAAAAAAGCTCGAGGGCGTGGTTTTACCCCCCCCCACCACCACCACCAAATAACATTTG TTCTCTCGTTGCCAGGGGATGGGAGATCATGTTTCCGTTCATTCCTACCACCCGCTTCACTGCTTCGTCAAGACACACCG ATTCTGTCCGCAAAAAGAGAGACAACAGATGAGCAAACACAGGCCAGAATCAGTTATAAAAGAAAAGGAGAGGTGCACAA GAAGTAAAAAACATAAAACATAAAACATAAAACATAAAACATAAAACATA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1745919: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17459193216860AI007350TENU0370T.cruzi epimastigote normalized cDNA Library


Date: 2:47:16 on Fri 24 Nov 117.