EST 1745921 is a singleton


Sequence

>1745921 (1 EST) Length=197 AAACAAAAACAAAAGGGAAAAGGAAGTATAAAAATAATATATAAATAATCATTAATGCTTTAAGACGGCATATATATATA TATATATATAGACATACAGAAGTGTGGGTAATATTTGTAAATGCTCCTTTTCCATCAGTTCTTCCATTTCCCTACAATCA TCATGCCTTTGACACTTCTCCACCCTCACCACACTCA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1745921: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17459213216862AI007352TENU0372T.cruzi epimastigote normalized cDNA Library


Date: 20:53:19 on Sun 19 Nov 117.