EST 1745923 is a singleton


Sequence

>1745923 (1 EST) Length=336 AATAAAAAAAATATGCGTCTGGATGAAACCTTTTCACATTTACCCCGAAGAAGAAAGAACACAAATACGGGAGGACAAAT TTTCGTTCAATGTGCCCTATATTGCTCACCTCAGAAAAAATTCATAGAAAACTCACATCAATAAACAAATTCAAAGGGCA TACATGTTACAAAACCCGGGCACTTTGCGAACGCACATAGCGGCATTCTCTTTGCGGAACCGCAACCACCGGATTCCCCC GCGTGAAGGGTAACGGATAGTGGGTAGAACAGAAGAGGAGAAAGAGCTGCACTCGATACCTTCCAACGCGGTGTCCCTGG AAGCAAAACTAAAGTA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1745923: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17459233216864AI007354TENU0374T.cruzi epimastigote normalized cDNA Library


Date: 13:48:45 on Mon 20 Nov 117.