EST 1745925 is a singleton


Sequence

>1745925 (1 EST) Length=390 CTCGTCTCTCTCTTTTTTTTTTTTTTTTTTACTACTGCTCGAAACCCACCGAATTTGGTGTCATGGCTGCAACTTTTTCG TGAGGCTCACCATCGTTTTCGTGCACTGGAGGCGCCTCGACGGGAGTANACGCCGCGTGGTCGGTGCCGACAAAACCCTC AGCCTCTCCATACTCCTGCGCCTCAGGGAGAGACGAGACTGCCACTGCACTCACTCGTGGGGTGCGCGGAAAGGTCGGGA GACCCACACGAATGACACGCTGGGGTGGAATTGGACGCACACCACCGCGATTGACAACACCGTTTGGCCGTTTGATAACA CTGGAGTCAGCTGTATTTGCAACCTGCTTGGAGACACTGGCTGGCCCTTCGGAAATTCTTCCTCGCGATG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1745925: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17459253216866AI007356TENU0376T.cruzi epimastigote normalized cDNA Library


Date: 0:52:46 on Wed 22 Nov 117.