EST 1745928 is a singleton


Sequence

>1745928 (1 EST) Length=446 GCTGCGGCTTGCCAATGGCACGAGGTTTGGATGATGGGACTGTCGGAAAAAGGGATGGGAGCCCTAAAATTCCGCTTTGA TGCGATTTCACCCAGACTGCAGCTGCGCCGGCAACAAAGGGCTTGATAAAGGACGAAATGCACTGAAGTCGCTGAAGAAA TAATAATAATAAAAAAAAAGCACCCGAAGATTTCAATACGCGGAATTATGGTCTTCTCACCGCGGTGGTGTTTTGTCGAT TTGAGGGCGATGGGCGGCCCGGAGATTTCGTGGCACGTGGGTGCAAAAGACGGCAGCGTCTGTGGCCCCGATGGGCGTCA GGGAGACGTCTCCGGAATGCGGGATCACGTACGGGATGTTTTTTTTTTTTTTTGTCTTGGCTTCCATGATGAAGAGGCCG CTGCTGCTTTGGTCATGGCACCAACAGANACACACACACACATGTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1745928: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17459283216869AI007359TENU0379T.cruzi epimastigote normalized cDNA Library


Date: 11:52:42 on Thu 23 Nov 117.