EST 1745934 is a singleton


Sequence

>1745934 (1 EST) Length=342 CGGCCGAATGGCGAGACGGAACACGTGGGGGCGGATGCTGTCATTTTGTGTGCCGGGGGAATTGGCACACCCCGTTTACT CGCCTGTTCGCAGGGAACACTTTCAATCGATCCCGCGGTGGGCACAAATTTCTGGGACAAACCGCAGTCAAGATGCAGTT CCGAACCCGCATTCCTTTAAGTCACAACTGTTTCATGGAGCCAATTGTACAGATGTGCATAGGAATAAACCTCAGGTACG GCAACCCGCTGCATGCACTGTGCTCTGCGTACGATGACATGATCTGCTATTGGTCCAGCAGTGGGGAGCAAACGCCGGAC GTAAAATTTATTTTTCAGCCAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1745934: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17459343216875AI007365TENU0385T.cruzi epimastigote normalized cDNA Library


Date: 9:56:56 on Wed 22 Nov 117.