EST 1745937 is a singleton


Sequence

>1745937 (1 EST) Length=299 CATCCATAAAAAAGAAAAAAAAGAAAAAAAAAGAAACCATTAAGAAATACATTTGGGCTATTCTTTCCTTCTTTTTTGTC CTTCCCTCTTGCTCCTAGGATTCCAATGGATACAACGAGAACTCGTAAATAAGAAGAAAAAAAAATGAACAACAAAAAGG CAAAATACCTGCCCATATTCAATTTACATTTTTTCTGAGGAACCAATGGTGGAGTTAAAGCTTTTTTTGTAAAAGGTACT CTCGTACCGGTAGTGTCCTGGACCAGGATTGCCGACCTCGTTGCCAGAATTAAACCTTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1745937: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17459373216878AI007368TENU0388T.cruzi epimastigote normalized cDNA Library


Date: 13:2:47 on Sun 19 Nov 117.