EST 1745943 is a singleton


Sequence

>1745943 (1 EST) Length=353 CAGAAAATAAATAAAAAACAATAAGAAAAAGAGAGAATTGTGACTGGTCGCATCAACGGCATATCACCATTTCATTTTCC GCCGCTTCCTATTCGTCGTCGTCGCCGGAGCTCACGCGGACGATAAATGACGGGATGGTCACAATCTGCTTGGCCACCGC AATGTGGCGCTGCAGAATGAGCACACGTGCGTGGTGGACAGACTTGGCAAGGCCGTGCTTGAATACCACGGTCTGGAGGC GGCGCTCGAGAATGTCGGGGACGGTGAGCGAGAGGACGTAATCGAGTTTGTCCTTCTCCTCCTCGAGGAAGCCGTAGTCG TGGCAGCGGCGCATGATGGCGGAACCCTCCAGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST, Processing,


Cluster Information for 1745943: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17459433216884AI007374TENU0394T.cruzi epimastigote normalized cDNA Library


Date: 14:44:16 on Sun 19 Nov 117.